Class 12 Biology - Chapter Molecular Basis of Inheritance NCERT Solutions | If the sequence of one strand of DNA is
If the sequence of one strand of DNA is written as follows:
5-ATGCATGCATGCATGCATGCATGCATGC-3
Write down the sequence of complementary strand in 5→3 direction
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in direction will be
3'- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in direction is
5'- GCATGCATGCATGCATGCATGCATGCAT− 3’
More Questions From Class 12 Biology - Chapter Molecular Basis of Inhertance
- Q:- What is DNA fingerprinting? Mention its application.
- Q:- Differentiate between the followings:
(a) Repetitive DNA and Satellite DNA
(b) mRNA and tRNA
(c) Template strand and Coding strand - Q:- If the sequence of the coding strand in a transcription unit is written as follows:
5-ATGCATGCATGCATGCATGCATGCATGC-3
Write down the sequence of mRNA. - Q:- How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
- Q:- Explain (in one or two lines) the function of the followings:
(a) Promoter
(b) tRNA
(c) Exons - Q:-
Why is the Human Genome project called a mega project?
- Q:- List two essential roles of ribosome during translation.
- Q:- Which property of DNA double helix led Watson and Crick to hypothesise semi-conservative mode of DNA replication? Explain.
- Q:- In the medium where E. coli was growing, lactose was added, which induced the lac operon. Then, why does lac operon shut down some time after addition of lactose in the medium?
- Q:- If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Popular Questions of Class 12 Biology
- Q:- Why is reproduction essential for organisms? Answer
- Q:- Name the parts of an angiosperm flower in which development of male and female gametophyte take place.
- Q:-
Fill in the blanks:
(a) Humans reproduce __________. (asexually/sexually)
(b) Humans are__________. (oviparous/viviparous/ovoviviparous)
(c) Fertilization is __________ in humans. (external/internal)
(d) Male and female gametes are __________. (diploid/haploid)
(e) Zygote is __________. (diploid/haploid)
(f) The process of release of the ovum from a mature follicle is called__________.
(g) Ovulation is induced by a hormone called the __________.
(h) The fusion of male and female gametes is called _____________.
(i) Fertilisation takes place in _____________.
(j) Zygote divides to form _____________which is implanted in uterus.
(k) The structure which provides vascular connection between fetus and uterus is called ____________. - Q:- What do you think is the significance of reproductive health in a society?
- Q:- Mention the advantages of selecting pea plant for experiment by Mendel.
- Q:- Explain antibiotic resistance observed in bacteria in light of Darwinian selection theory.
- Q:- What are the various public health measures, which you would suggest as safeguard against infectious diseases?
- Q:- Explain in brief the role of animal husbandry in human welfare.
- Q:- Bacteria cannot be seen with the naked eyes, but these can be seen with the help of a microscope. If you have to carry a sample from your home to your biology laboratory to demonstrate the presence of microbes under a microscope, which sample would you carry and why?
- Q:- Can you list 10 recombinant proteins which are used in medical practice? Find out where they are used as therapeutics (use the internet).
Recently Viewed Questions of Class 12 Biology
- Q:- Why is reproduction essential for organisms? Answer
- Q:- Name the three important components of biodiversity.
- Q:- Why are offspring of oviparous animals at a greater risk as compared to offspring of viviparous animals?
- Q:- Among the ecosystem services are control of floods and soil erosion. How is this achieved by the biotic components of the ecosystem?
- Q:- Find out from newspapers and popular science articles any new fossil discoveries or controversies about evolution.
- Q:-
Define external fertilization. Mention its disadvantages.
- Q:-
Mention two strategies evolved to prevent self-pollination in flowers.
- Q:- Define population and community.
- Q:- How is diapause different from hibernation?
- Q:- List the harmful effects caused by alcohol/drug abuse.
- All Chapters Of Class 12 Biology
- All Subjects Of Class 12