If the sequence of one strand of DNA is | Class 12 Biology Chapter Molecular Basis of Inheritance, Molecular Basis of Inheritance NCERT Solutions

Welcome to the NCERT Solutions for Class 12 Biology - Chapter Molecular Basis of Inheritance. This page offers a step-by-step solution to the specific question from Exercise 1, Question 3: . With detailed answers and explanations for each chapter, students can strengthen their understanding and prepare confidently for exams. Ideal for CBSE and other board students, this resource will simplify your study experience.

Question 3: If the sequence of one strand of DNA is written as follows:
5-ATGCATGCATGCATGCATGCATGCATGC-3
Write down the sequence of complementary strand in 5→3 direction
Answer:

The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is

5'- ATGCATGCATGCATGCATGCATGCATGC − 3’

Then, the sequence of complementary strand in direction will be

3'- TACGTACGTACGTACGTACGTACGTACG − 5’

Therefore, the sequence of nucleotides on DNA polypeptide in direction is

5'- GCATGCATGCATGCATGCATGCATGCAT− 3’


Study Tips for Answering NCERT Questions:

NCERT questions are designed to test your understanding of the concepts and theories discussed in the chapter. Here are some tips to help you answer NCERT questions effectively:

  • Read the question carefully and focus on the core concept being asked.
  • Reference examples and data from the chapter when answering questions about Molecular Basis of Inheritance.
  • Review previous year question papers to get an idea of how such questions may be framed in exams.
  • Practice answering questions within the time limit to improve your speed and accuracy.
  • Discuss your answers with your teachers or peers to get feedback and improve your understanding.

Latest Blog Posts

Stay updated with our latest educational content and study tips

Why Self-Discipline is More Important Than Motivation for Students

Have you ever noticed that doing activities such as playing outdoors, chilling with your friends, or using the mobile phone feels so effortless and fun? Whenever you might have played sports, you kept on playing even when it felt hard initially just so you could get that feeling after the game, a feeling of accomplishment, […]

Read More

How Visualization Strategies Can Improve Test Performance

Imagine this; You’re sitting in the test hall, pen in hand, and the question paper has been put in front of you. Rather than freezing, you feel calm, collected, and set. Why? As you have formerly been there in your mind. You’ve seen yourself sitting composibly, reviewing the question paper fluently, performing well in the […]

Read More

Smart Questions to Ask in a Parent-Teacher Meeting | PTM Made Easy

Parent-Teacher Meetings (PTMs) are more than quick updates on marks — they’re a chance to build a real partnership between home and school. A good Parent-Teacher Meeting conversation helps parents see beyond grades. It opens up insights about a child’s strengths, struggles, emotions and even hidden talents. When parents participate actively, they don’t just track […]

Read More

The Secret to Smarter Learning — Building Strong Critical Thinking Skills

In today’s world of endless information , knowing how to think is more important than knowing what to think . From school projects to real – life decisions , critical thinking helps students question ideas , analyze facts and form logical conclusions . But what exactly does critical thinking mean ? Simply put , it’s […]

Read More

Add Comment

Welcome to the NCERT Solutions for Class 12 Biology - Chapter . This page offers a step-by-step solution to the specific question from Excercise 1 , Question 3: If the sequence of one strand of DNA is written as follows: 5-ATGCATGCATGCATGCATGCATGCATGC-3 Write d....